1. Este site usa cookies. Ao continuar a usar este site está a concordar com o nosso uso de cookies. Saber Mais.

Problema RNA : 11 horas de volta disto. resultados =0, ajudas?

Discussão em 'Programação' iniciada por PedroPereiraStr, 10 de Abril de 2008. (Respostas: 5; Visualizações: 766)

  1. PedroPereiraStr

    PedroPereiraStr Power Member

    Pessoal tenho o seguinte problema:

    Uma molécula de RNA é constituída por uma longa cadeia de amino-ácidos de quatro tipos: adenina (A), citosina (C), guanina (G) e uracilo (U). Tal como no DNA, estas bases emparelham-se duas a duas: a adenina com o uracilo, a citosina com a guanina.

    As ansas têm um papel especial nos mecanismos biológicos, pelo que é importante conseguir detectá-las a partir da representação linear da cadeia. Para identificar uma ansa, é necessário saber a base em que começa, o seu comprimento e o número de bases não emparelhadas. A título de exemplo, considere a cadeia seguinte.

    Numerando as bases da esquerda para a direita, encontram-se (entre outras) as seguintes ansas. InícioComprimentoNão Emparelhadas(i)2100(ii)5135(iii)10164(iv)19122

    em imagens :

    caso (i)

    caso (ii)

    caso (iii)

    caso (iv)


    usando stack's tenho que obter o seguinte resultado:

    Introduza a cadeia a testar: AGUAUCGAUACGCUCGAAUGAGCGUGCUCA
    Pesquisar ansas com quantas bases não emparelhadas? 0
    Início: 2; Comprimento: 10
    Início: 11; Comprimento: 2
    Início: 12; Comprimento: 2
    Início: 14; Comprimento: 4
    Início: 18; Comprimento: 2
    Início: 22; Comprimento: 2
    Início: 23; Comprimento: 2
    Início: 26; Comprimento: 2
    Pesquisar ansas com quantas bases não emparelhadas? 5
    Início: 5; Comprimento: 13
    Pesquisar ansas com quantas bases não emparelhadas? 4
    Início: 3; Comprimento: 6
    Início: 5; Comprimento: 6
    Início: 10; Comprimento: 16
    Início: 24; Comprimento: 6
    Pesquisar ansas com quantas bases não emparelhadas? 2
    Início: 11; Comprimento: 6
    Início: 19; Comprimento: 12

    --------------/* FIM ENUNCIADO*/---------------

    Alguem dá sugestões e afins? epa bolas, 11 horas caraças, que nabice do arco da velha =\.........java leets onde andam?


    PS: aguardo sugestões enquanto me vou queimando mais um pouco......
    Última edição: 10 de Abril de 2008
  2. arkannis

    arkannis Power Member

    Um conselho de quem também já andou (e ainda ando) à volta desse enunciado:
    Usa e abusa do debugger, é que o algoritmo necessário tem tanto pequeno pormenor, e basta um desses pormenores estar mal, para o resultado dar completamente marado.
    Portanto, pensa uma solução na tua cabeça, traduz os pensamentos para java. Agora corre o programa. Não deu? Abre o debugger e vai passo a passo, observando a composição das pilhas (se estiveres a usar) a cada iteração e tentando perceber o que está errado.
  3. Se puseres aqui o código que já tens vai ser mais fazer ajudar. :)
  4. PedroPereiraStr

    PedroPereiraStr Power Member

    nao o queria fazer pois numa cadeira com mais de 100 alunos algum terá acesso ao meu código, e como deves calcular não é muito saudável. Fogo esta noite até andei a pensar nisto dass xD

    Já comecei outra vez, e fiz outro algoritmo usando pilhas. Como o user disse, debugger a potes, mas fazer debug de 70 linhas de código com uma boa quantidade de ciclos,pilhas, e outras estruturas de dados não é propriamente fácil lol.

    Como disseste são muitos pormenores mesmo, e tenho andado a corrigir alguns, já fiz "debug" no papel também mesmo por isso, e já descobri uma boa quantidade deles. Agora está-me a correr sem erros, mas não me dá o output que era. Fonix as horas que tou de volta disto...

    Cumprimentos, e desde já obrigado. Alguma sugestão depois apitem.

    Se me lembrar, no fim do projecto ser corrigido e conseguir achar uma solução correcta mostro o meu código.
  5. napalm

    napalm Power Member

    Em todos os casos as não emparelhadas estão no topo, é obrigatório que tal aconteça?
  6. PedroPereiraStr

    PedroPereiraStr Power Member

    yep :)

Partilhar esta Página